miaxmuro miaxmuro

02-05-2020
Mathematics

contestada

which point on the number line has the greatest absolute value?

1. Q (-4)

2. S (0)

3. R (-1)

4. T (3)

Respuesta :

itsabookworm itsabookworm

02-05-2020

Answer:

I thinks its T (3)

Step-by-step explanation:

Answer Link

cgaluten cgaluten

02-05-2020

The answer is T (3) has the greatest absolute value

Answer Link

Otras preguntas

What distinguished the bantu religion from buddhism, christianity, and islam?

Make w the subject of Y-aw=2w-1

Application of force with movement is called _______________ exercise.

During the germinal period of prenatal development, some cells become part of the brain, some become part of the leg, and some become part of the stomach, etc.

Raquel recently received a poor grade on a school assignment. Her mother has noticed that Raquel is staying up late at night and hides in her room. Raquel is re

Find the least common multiple of the pair of polynomials. 2y^2-32 and y+4

Which English reformer called for change in the church during the 1300's

A string of lights contains three lights. the lights are wired in series, so that if any light fails the whole string will go dark. each light has probability .

You analyze a cell. the cell starts with two moles of glucose and you see five moles of pyruvate appear. how many atp were produced by glycolysis

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat