missdee839 missdee839
  • 03-01-2020
  • Chemistry
contestada

When two atoms share electrons in order to have a completed outer shell, the bond is referred to as a:________.

Respuesta :

keithdariusbelyue keithdariusbelyue
  • 03-01-2020

Answer:

Covalent bond

Explanation:

Ionic bond- When 1 atom totally transfers 1 or more electron to another atom in order to reach stability.

Covalent bond- Is when 2 atoms share there electrons instead of transferring them so they both would be at a stable configuration.

Answer Link

Otras preguntas

the area of a rectangular garden is 38 1/4 square meters. the width of the garden is 4 1/2 meters. find the length of the garden
p(x) x^3+x^2-x-1 Find all zeros of p (x)
The process of chemical cycling is known as a biogeochemical cycle because it A. takes places over a long period of time B. withdraws the
Jimmy pays $2.93 for each gallon of gas. Which table best represents the relationship between g, the number of gallons purchased, and m, the amount he pays for
What was religion like in Shang China?
if a star is shown ti be 33.11 trillion killometers away , how many light year would that be
who fought against each other in the crusades?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
lya took one hour to drive from his apartment to Philips Arena and back. The return drive took 8 minutes less than the trip to the arena. If x represents the ti
Which theater is considered Shakespeare's theater? A. The Swan B. The Globe C. The Rose D. The Stage