owenweichel owenweichel

15-11-2019
Mathematics

contestada

Janelle earned 90% on a test and got 63 points. How many total points were possible on the test?

Respuesta :

matthew900 matthew900

15-11-2019

Answer:

total points possible were 70

Step-by-step explanation:

Answer Link

EpicDoge420 EpicDoge420

15-11-2019

70 points

63 divided by 9 is 7 and 63+7=70 so 70 points

Answer Link

Otras preguntas

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein

Two sentences with stagnate. Stagnate means to stop moving forward or to stand still.

what landforms caused the Chinese to have little contact with other civilizations?

1 million =_____________ hundred thousand

Brianna planted daffodils and tulips in her garden she planted 4 daffodils for every 3 tulips if Brianna planted 28 flowers in all how many tulips did she plant

what is an asexual structure where spores develope?

You rent a boat for $1.00 per hour plus a $15.00 insurance fee. Your friend rents another boat for $4.00 per hour and no fee. For how many hours will you end up

A rectangle has an area of 35 square meters what could the length and width be

Find the surface area of the composite solid.

Read the following plot synopsis: Callie wanted nothing more than to be on TV. She went to Hollywood to try to get a part. At first things were tough, but event