AlonsoE AlonsoE

02-10-2019
English

contestada

Rising action
Introduction
Falling action
Climax
Resolution

Respuesta :

YvesMia YvesMia

03-10-2019

Answer:

Rising Action: building tension

Falling Action: tying up loose ends

Climax: The exiting bit for the protagonist

Resolution: ending the story

Answer Link

Otras preguntas

How are STDs contracted and why are they spread so easily?

Anyone wants my number for 84 points

URGENT I'll give you stars, brainliest answer, or slide into ur dms for this answer pls9^(x2)=y in log form

help please According to the data what kind of substance is gastric juice? A. it is a weak acid since the blue litmus paper turns red and the pH is 1.7 B.

Hi guys please help me with this! exlapin how you got the answer instead of just putting down a random letter for points, thanks! :)

4. Analyzing What was life like in Mogul society?

2 2.1.3 Quiz: Understand Conflict and Plot ZA Question 4 of 10 Read this passage: Pavel, a nuclear engineer, works at a nuclear power plant. He notices that the

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein

Question How many solutions does the system of nonlinear equations graphed below have?

Which of the following molecules have a dipole moment?Select one or more:CS2SeS2CINOВСІЗCClaF2CO2PCIECom