msmatthewgray msmatthewgray
  • 16-02-2019
  • Mathematics
contestada

What is the equivalent expression of 49×(v×u)

Respuesta :

candi65 candi65
  • 16-02-2019

there can be multiple equivalent expressions such as 49×(23×13)

Answer Link
ally310
ally310 ally310
  • 16-02-2019
49uv I hope this helps
Answer Link

Otras preguntas

Describe how you regroup when you find the sum of 64 +43
Llena el espacio con la palabra correcta. Word Bank: me, te, le, nos, les. El _________botones a0 dice la información. (a ellas
9% of what equals 4.5
What are the advantages a market economy offers producers? (there is more than one answer) A: minimal government intervention B: property rights C: monopoly of
What is an example of a compatible number?
Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequences are always written 5' to 3
According to Article I of the U.S. Constitution, who has "the sole Power to try all Impeachments?"
what types of lipids does a person want to avoid to prevent atherosclerosis from developing? What types of lipids would be better to prevent atherosclerosis?
what plant pigment is involved? in photosynthesis
6 less than the product of a number and 3 is -18..what is the number?