dolphMurdobri4eler
dolphMurdobri4eler
01-04-2016
Biology
contestada
What is a laminaria?
Respuesta :
Аноним
Аноним
01-04-2016
Laminaria are the brown algae or kelp. They are found in the north Atlantic Ocean.
Answer Link
VER TODAS LAS RESPUESTAS ( 73+ )
Otras preguntas
on a game show that are 10 keys in the bag and three of the key start a car and contest in randomly choosing the key it doesn't not start the car she returned t
Muhammad is purchasing an air purifier for $143.95, including tax. He gives the sales clerk 1 fifty-dollar bill, 3 twenty-dollar bills, and 4 ten-dollar bills.
Find the total number of possible outcomes for 10 styles of running shoes, each in a men’s and women’s version.
Normal hemoglobin DNA - cacgtggactgaggactcctc What is the normal hemoglodin acid- Normal hemoglobin A.A sequnce For figuring out RNA A binds with U C binds
What is the slope of the line that is parallel to the y-axis and passes through the point (–1, 5)? –1 0 5 undefined
Samuel has a life insurance policy that will pay his family $40,000 per year if he dies. If interest rates are at 4.0% when the insurance company has to pay, wh
Describe the main differences between the inheritance patterns for a dimpled chin and for height
janis and susan went to a clearance sale at a clothing store all blouses were selling for the same price and all skirts were selling for the same price janis bo
A population of 240 birds increases at a rate of 16% annually. Jemel writes an exponential function of the form f(x) = abx to represent the number of birds afte
There are 9 students in a class: 5 boys and 4 girls. If the teacher picks a group of 4 at random, what is the probability that everyone in the group is a boy?
