Tyus101 Tyus101
  • 12-09-2018
  • Mathematics
contestada

7 + 3x - 5 (6x + 2) = 8

Respuesta :

emmi33 emmi33
  • 12-09-2018
You should get -1/3 as ur answer
Ver imagen emmi33
Answer Link

Otras preguntas

Yvonne and Garret are looking at information about how their organization's products could fit potential customers' needs. This information deals with demograph
Reset the PhET simulation (using the button in the lower right) and set it up in the following manner: select Oscillate, select No End, and use the parameters i
Please help! I will give Brainliest! I am stuck.
A restriction enzyme is coded for: AT!GC How long would the Base Pair fragments be for this DNA sequence? AGTCGAGTATATGCATGGCCGCGAT 1)25 and 0 2)25 and 25 3)14
find the missing side
which pair of numbers does NOT satisfy the relationship shown in the graph?
The value of Broadway-Brooks Inc.'s operations is $900 million, based on the free cash flow valuation model. Its balance sheet shows $30 million in short-term i
Find the sum of 16,8,4...
Students were asked to write 6x + Xx - 3x + in standard form. Shown below are four student responses. Which student is correct?
Spotted owls exist in multiple variations. Two species are shown in the image above. What answer below BEST DESCRIBES the cause & effect of the two differ