Gigiwilson05
Gigiwilson05 Gigiwilson05
  • 03-09-2014
  • Mathematics
contestada

what is the relationship between the values of the 4s in 4,438

Respuesta :

mashenka
mashenka mashenka
  • 03-09-2014
They do not mean the same thing:
4 in 4000 stands for 4 thousands
4 in 400 stands for 4 hundreds
In this case:
[tex] 4 438 = 4 \cdot 1000 + 4 \cdot 400 + 3 \cdot 30 + 8 [/tex]
You can see, that first '4' means 4 000, while the second one means 400, so the first one is 10 times greater.
Answer Link

Otras preguntas

It’s quick... could you please check this?? Please. 8.04 LEÇON LEQUEL I don’t know if I have to include Lequel, I’m just very confused 1.) Write in a simple se
Three largest countries under German occupation by 1940
PLZZZZZZZ help find mRNA and A.A sequnce to this Sickle cell hemoglobin DNA- cacgtggactgaggacacctc Sickle cells hemglobin mRNA- Sickle Cell shemoglobin A.A se
True or false While in school at Jerusalem Paul may have stayed at the home of his married sister
The area of a rectangular wall of a barn is 220 square feet. its length is 12 feet longer than the width. find the length and width of the wall of the barn.
Which is not a categories of development in a lifespan? physical, informational mental, emotional
Jerry is a judge. He hears 555 cases every 2 3/8. Jerry hears cases at a constant rate. How many cases does he hear per hour?
a woman with type o blood marries a man with type ab blood is it possible for their children to have O blood
Bacteria that produce vitamins are residents of what organ within the digestive system?
What is the area of the rectangle?