Farhan98 Farhan98
  • 15-04-2024
  • Mathematics
contestada

Round off 1519.71 to the nearest 10

Respuesta :

Otras preguntas

The word "old" in the phrase "the old man" is what part of speech?
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the mRNA of the
The center has a circular pond with a diameter of 20 M what is the approximate area of the pond
What is the significance of Antietam in relation to the Civil War?
Which statement is true regarding Type 2 diabetes?
Classical drama evolved about the fifth century B.C. In
which describes pitches rhythms and tone colors woven together to create layers of sound in a song
Read the excerpt from FDR's Fireside Chat #7, and then answer the question. “I occasionally leave this scene of action for a few days to go fishing or to go ba
If the people of Cerritos traded with the people of Mayapán, what goods might they exchange
In three to five sentences, describe one common myth about classical music and refute it.