bunng5264 bunng5264
  • 12-03-2024
  • Mathematics
contestada

If A and B are independent events with P(A) = 0.1 and P(B) = 0.8, find P(A AND B). Give your answer as a decimal rounded to two decimal places.

Respuesta :

Otras preguntas

round 7,782 to the nearest hundred
the area of a rectangular garden is 38 1/4 square meters. the width of the garden is 4 1/2 meters. find the length of the garden
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
the volume of a rectangle prism with square bases is 5880 cubic inches. it has a height of 30 inches. find the side length of the square base.
Which is an example of a structural adaptation of a plant? A. plant moving toward light to increase photosynthesis B. roots responding to gravity to get to wa
How many combinations of 5 students can a teacher choose from 24 students? A. 5,100,480 B. 42,504 C. 7,962,624 D. 120
if a star is shown ti be 33.11 trillion killometers away , how many light year would that be
the temperature of a sample of matter is a measure of the ?
Susan ........ (Run) to school because she was late.
What are some methods used by Mussolini to rise to power?