sharidler sharidler
  • 15-12-2022
  • Biology
contestada

original DNA: TACTTTAATCCCAAATTTACT

DNA: TACTTTAATCCCAAGTTTACT
mRNA: ?
amino acid: ?
what type of mutation is this: ?​

Respuesta :

Otras preguntas

name a metal that doesn't conduct electricity
What's the other word stubborn; inflexible
what is 12minus 2 multiply 6 plus 2 divide by 2
How would you call in other words to scold or punish severely
Molecular scientists can read the DNA code and compare the DNA of different organisms. This concept is used in molecular clocks to determine which of the follow
What's the other term for: lacking respect; scornful
what do I do to figure out this problem:3x+8=26+x
Which of the following steps is not critical in the creation of Bt corn?a.Cut out a piece of DNA from a DNA molecule.b.Splice a piece of DNA into DNA from anoth
What's the other word a weak or lifeless feeling
What's the word for looking down on others; proud and scornful