jenniferjuarez407
jenniferjuarez407 jenniferjuarez407
  • 12-12-2022
  • History
contestada

i don’t know what to do here can someone please help me! (20 points)

i dont know what to do here can someone please help me 20 points class=

Respuesta :

Otras preguntas

Kevin will take 4 math tests this term. All of the tests are worth the same number of points. After taking the first 3 tests, his mean test score is 88 points.
Do you think then solid can undergo convection
What was religion like in Shang China?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What is the diameter of a circle whose circumference measures 86 26/35? Use pi= 22/7
How did i travel irf i went from nyc to tren ton a distance of90 miles at45 miles per hour how long did it take
Which is an example of a structural adaptation of a plant? A. plant moving toward light to increase photosynthesis B. roots responding to gravity to get to wa
a tabletop in the shape a trapezoid has an area of 6550 square centimeters its longer base measures 115 centimeters and the shorter base is 85 centimeters what
what are 2 examples of ionic compound?
What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic