toritolkacevic0 toritolkacevic0
  • 11-11-2022
  • Mathematics
contestada

The state sales tax rate in North Carolina is 4.5% estimate the state sales tax on a model of the wright brothers’ airplane that costs $139.99.
Please show work

Respuesta :

Otras preguntas

define concentric circles
What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
_______ is the largest continental biome. It experiences long, cold winters; short, mild summers; and low precipitation. It is characterized by coniferous fore
what is 0.00001267 is scientific notation
a tabletop in the shape a trapezoid has an area of 6550 square centimeters its longer base measures 115 centimeters and the shorter base is 85 centimeters what
how can you write 0.45 as fraction and a percentage ,please show work
Simplify. (-1/2)(4times)(-2)(7y)(-1) A. –28xy B. –28 C. 28xy D. 27
Please help with math question and please show ALL work. 1....How many solutions does the equation 3x+x+3=2(2x+1)+1 have? 2...How many solutions does the pair
What are the qualities of a good topic? How will you ensure the topic you choose is relevant and interesting?